Powerpoint template for scientific posters (Swarthmore College)

Powerpoint template for scientific posters (Swarthmore College)

Species Identification of White Fish using PCR Techniques
Erin Chase
Advisor Dr. Tschunko
Results Continued

Introduction

Methods Continued

Species identification has recently become a hot topic in
the molecular and genetic world. It is easy to determine the
species of an animal, or fish, when it is sitting right in front of
you with its skin attached however most phenotypic marking
are removed from fish by the time it is puchased. There are
very few ways to determine the identity of the meat being
sold in the market (Dooley et al., 2005). One way to identify
the fish is to use proteins to determine the identity. This is
unreliable after the fish has been cooked since the protein has
become denatured (Dooley et al., 2005). DNA remains intact
after heating thus it is possible to test on the fish that is
bought from restaurants (Rastogi et al., 2006). DNA is
completely independent of tissue comparison therefore you
can test the DNA after the meat has been tampered with
(Rastogi et al., 2006. Mitochondrial DNA tends to be better
for use than chromosomal because there is more copies of it,
and therefore less likely to give false matches (Rastogi et al.,
2006). For this study Cytochrome C was used because it is a
highly conserved sequence (Pierron et al., 2011). Cytochrome
C is found in the inner membrane of the mitochondria where
it is part of the electron transport chain and acts as an
electron acceptor (Pierron et al., 2011).
White fish is a fisheries term used to describe any fish with
silvery flesh, such as Cod and Pollock. Fast food restaurants
claim that their fish sandwiches contain either Cod or Pollock.
This is important that all companies claim using both but not
in the same sandwich. PCR and DNA sequencing were used to
determine the sizes of the DNA fragments, and the sequence,
of Cod and Pollock. Along with Cod and Pollock four fast food
fish sandwiches were tested: McDonalds, Burger King, Long
John Silvers, and Captain Ds.

The primers were run through a thermocycler for 40
cycles. Denaturation occurred at 94oC for 2 minutes.
Annealing occurred at 35oC for one minute and elongation
occurred at 72oC for 2 minutes. This product went through gel
electrophoresis. Gels used were a 1.5% Agarose gel
containing Ethidium Bromide. Gels were run for 2 hours at
75 volts. After 2 hours the gel was placed on a UV light to
view the bands. Measurements were taken at this time.
The PCR product was also used for DNA sequencing.
This was done on a 6% polyacrylamide gel and stained using a
silver stain (Promega Corp.). The gel was loaded once with
the PCR product and let run for 2.5 hours and loaded again.
The gel ran at 1800 volts for a total of 5 hours. This went on
to staining and allowed to dry over night. Once drythe gel
was analyzed for the sequence. Due to problems with DNA
sequencing Cod, Pollock, and McDonalds were sent to
Seqwright for sequencing.

Hypothesis
Fast food fish sandwiches will contain Pollock.

Materials and Methods
Frozen Cod and Pollock were purchased from a local
grocery store and were kept at -20oC. Fast food fish
sandwiches came from McDonalds, Burger King, Long John
Silver, and Captain Ds. Each sandwich was a plain sandwich
with only the breading and the bun. The bun was discarded
and the breading removed before the sample was collected.
Fifty mg of fish meat was collected from the center of each
sandwich.
The samples under went cell lysis using Proteinase K and
10%SDS and incubated for a half hour in a 50oC water bath.
After lysis the fish went through a series of purification
steps. This included phenol, phenol:chloroform:isoamyl,
and chloroform:isoamyl steps. Once extracted the DNA was
purified and precipitated using absolute ethanol followed
by 70%ethanol. The DNA pellet was resuspended in TrisEDTA buffer. The DNA solution underwent PCR using the
primers H1478:TGACTGCAGAGGGTGACGGGCGGTGTGT and
L1091:AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT.

DNA fragment sizes found during gel electrophoresis were not diverse enough to be
useful for fish identification However the strong bands present indicate that all conditions
were optimal for PCR. The Sequencing gels did not produce a usable sequence although
some sequence was able to be read from the gel. In order to determine the type of fish
that was used the PCR product and primers were sent to Seqwright for sequencing. After
analyzing all the data the sequences were found for the Cod, Pollock, and McDonalds fish
sandwiches. When the sequences were compared to one another it was found that the
McDonalds fish sandwich is most similar to Pollock. This means that my hypothesis is
supported. However, the difference between percent similarity is so small that these
results should not be taken as conclusive. This means that although it looks like the fish in
McDonalds fish sandwiches is Pollock more tests are needed to prove anything indefinitely.
These results are however expected. Because the decision was made to amplify such a
highly conserved sequence the expectation was that the sequences would only be off by a
few nucleotides at best. Also due to money restraints only one fast food fish sandwich
could be sent out for sequencing so more tests need to be done to comment on the other
three fast food chains that were looked at.

Results
The gels produced bands that were not very distinct in sizes
from one another. A gel can be seen in Figure 1. The standard
used was PhiX HaeIII digest. From this a standard curve was
made and using the slope DNA fragment sizes were calculated
(Table 1).
Three sequencing gels were done, however none produced
a readable sequence. One gel can be seen in Figure 2. Because
of an inability to determine a sequence, DNA from Cod, Pollock,
and McDonalds fish were sent to Seqwright for sequencing.
The sequences for Cod, Pollock, and McDonalds can be seen in
Figure 3. This shows the bases that were different from the top
genome. From this the % match was able to be determined.
In Figure 3A the match between Pollock and McDonalds was
100% and between Cod and McDonalds there was a 92%
match. In Figure 3B the match between Pollock and McDonalds
was 98% and between Cod and McDonalds there was a 98%
match as well. The sequences were then inserted into
GenBank. All sequences came back as being from the
mitochondrial genome of the fish used in this experiment.
Molecular
Distance
Fish
Weight
Migrated (mm)
Projected (bp)
Pollock

65

486

Cod

65

486

McDonalds

64

509

Burger King

63.5

521

Long John Silver

64

509

Captain D's

64.5

497

Conclusions

Figure
Figure1.1.DNA
DNA
electrophoresis
electrophoresisgel.
gel. Gel
Gel
contains
containstwo
twopositive
positive
control
controlmarker
markerlanes
lanes(one
(one
on
oneach
eachside)
side)and
andthe
the
various
variousfish
fishsamples.
samples.InIn
the
theright
rightmost
mostlane
laneisis
Pollock,
Pollock,lane
lane22Cod,
Cod,lane
lane
33isisMcDonalds,
McDonalds,lane
lane44isis
Burger
BurgerKing,
King,lane
lane55isis
Long
LongJohn
JohnSilver,
Silver,and
andlane
lane
66isisCaptain
CaptainDs.
Ds.

Possible future experiments could be focused on how to improve the results obtained
in this study. This can be done by either improving on the primer, or even the techniques
that were used. The primer should be changed to a sequence that is less conserved than
the Cytochrome C. This is most likely why the percent match is so close for both Cod and
Pollock. To take this further in the future, many fast food chains have filler in their meat so
they can sell the sandwiches cheaper. Most fast food chains use wheat, corn, and/or soy as
the filler. It would be interesting to see the difference between the additives amongst the
different chains.

Acknowledgements
Figure
Figure2.2.DNA
DNA
sequencing
sequencinggel.
gel.This
This
isisaasmall
smallportion
portionofof
aagel
gelthat
thatproduced
produced
some
somebanding.
banding.

AA

References

BB

Table
Table1.1.Distance
DistanceDNA
DNAtraveled,
traveled,ininmillimeters,
millimeters,for
foreach
eachfish
fish
sandwich
sandwichand
andtheir
theircorresponding
correspondingmolecular
molecularweights.
weights.

Figure
Figure3.3.Sequence
SequenceofofFish
FishSandwiches.
Sandwiches.The
Thedots
dotsshow
showwhere
wherethere
thereare
aresimilarities
similaritiesininthe
thesequence
sequence
and
andififthere
thereisisaabase
baseinstead
insteadofofaadot
dotthat
thatmeans
meansinstead
insteadofofan
anAAthere
thereisisaaG.
G.NNstands
standsfor
forany
anybase.
base.
McDonalds
McDonaldsisislabeled
labeledA.A.(A.)
(A.)This
Thisshows
showsthe
thesequence
sequenceofofPollock
Pollockand
andMcDonalds
McDonaldscompared
comparedto
toCod
Cod
for
forthe
theprimer
primerL1091.
L1091.(B.)
(B.)This
Thisshows
showsthe
thesequence
sequenceofofPollock
Pollockand
andCod
Codcompared
comparedto
toMcDonalds
McDonaldsfor
for
the
theprimer
primerH1478.
H1478. Around
Aroundbase
base50
50two
twoNs
Nswere
wereinserted
insertedinto
intothe
thesequence
sequencefor
forMcDonalds.
McDonalds.
Electrophoresis
Electrophoresisunit
unit

Thermocycler
Thermocycler

Electrophoresis
Electrophoresisunit
unit

I would like to give a special thanks to
Dr. Tschunko my advisor. Dr Brown my
unofficial second advisor.
The Marietta
College Department of Biology and
Environmental Science for funding this
project and also providing the lab space for
experimentation. I would also like to thank
Dr. McShaffery, my capstone class advisor
who helped teach me how to take pictures of
gels under UV light. Finally, I would like to
thank my fellow senior capstone students for
helping me brainstorm.

Barai BK, Nayak RR, Singhal RS, Kulkarni PR.
1992.Approaches to the Detection of Meat
Adulteration. Trend in Food Science and Technology
3:69-72.
Dooley JJ, Sage HD, Clarke MAL, Brown HM, Garrett
SD. 2005. Fish Species Identification Using PCR-RFLP
Analysis and Lab-on-a-Chip Capillary Electrophoresis:
Application to Detect White Species Fish in Food
Products and an Interlaboratory Study. Journal of
Agricultural and Food Chemistry 53:3348-3357.
Gil LA. 2007. PCR Methods for Fish and Fishery
Products Authentication. Trend in Food Science and
Technology 18:558-566.
Pierron D, Opazo JC, Heiske M, Papper Z, Uddin M,
Chand G, Wildman DE, Romero R, Goodman M,
Grossman LI. 2011. Silencing, positive selection and
parallel evolution: busy history of primate cytochomes
c. PLoS ONE 6(10): 1-8.
Rastogi G, Dharne MS, Walujkar S, Kumar A, Patole
MS, Shouche YS. 2006. Species identification and
authentication of tissues of animal origin using
mitochondrial and nuclear markers. Meat Science 76:
666674.

Recently Viewed Presentations

  • SS7G10 The student will discuss environmental issues across ...

    SS7G10 The student will discuss environmental issues across ...

    Ganges River Ganges River Yangtze River Yangtze River Yangtze River Air pollution in India Many cities are being choked by a cocktail of dust and chemical particles in the air. Every day 1.5 billion people are exposed to levels of...
  • How much do you know about Spain? Espaa

    How much do you know about Spain? Espaa

    3. Spanish area: Spain is the second largest country in Western Europe and the European Union, and the fifth largest country in Europe. 4. Spanish people: 47.1 million. The immigrant population, which has increasingly entered Spain since the mid-1980s, is...
  • Concrete Steps into 3G Mobility & Margin

    Concrete Steps into 3G Mobility & Margin

    These applications are primarily for business markets, although several also serve consumer markets, such as education and online healthcare • mobile office - horizontal business services common to a wide range of industries and individuals, such as corporate database access,...
  • Differential Privacy SIGMOD 2012 Tutorial Part 1: Motivation

    Differential Privacy SIGMOD 2012 Tutorial Part 1: Motivation

    Many important applications involve publishing sensitive data about individuals. Urban planning. Where do people live, work, and play, e.g., as tracked by their phone's GPS?
  • Scaffolding Reading Comprehension

    Scaffolding Reading Comprehension

    SCAFFOLDING READING COMPREHENSION OFFICE OF SPECIAL PROGRAMS Give participants 5 minutes to create three student friendly explanations. Time permitting, ask #1's to share examples for each word. * This is a great resource for use in generating your student friendly...
  • Chapter 5

    Chapter 5

    for (i = 5; i >= 1; i--) Answer: ***** **** *** ** * C++ Programming: From Problem Analysis to Program Design, Fourth Edition * Summary C++ has three looping (repetition) structures: while, for, and do…while while, for, and do...
  • Reinvigorating Teacher Professionalism

    Reinvigorating Teacher Professionalism

    GTCS Professional Recognition Awards. Professional Recognition provides . the opportunity for those who are . fully registered with the GTCS and . have completed one year of . professional practice to focus . on and develop their . professional learning...
  • Zeus / x366 PMP - IBM

    Zeus / x366 PMP - IBM

    IBM System x New Generation Server x3400 M2 제품소개서